mito-EcSTH-LbNOX
(Plasmid
#211922)
-
PurposeMitochondrial localization of EcSTH-LbNOX
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211922 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLVX-TRE3G-IRES-Vector
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemito-EcSTH-LbNOX
-
SpeciesSynthetic
-
Insert Size (bp)2932
-
Tag
/ Fusion Protein
- 3xFLAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GATAGAGAACGTATGTCGAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We recommend cloning this cDNA into an inducible expression vector system for expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mito-EcSTH-LbNOX was a gift from Binghui Li (Addgene plasmid # 211922 ; http://n2t.net/addgene:211922 ; RRID:Addgene_211922) -
For your References section:
Identification of purine biosynthesis as an NADH-sensing pathway to mediate energy stress. Yang R, Yang C, Ma L, Zhao Y, Guo Z, Niu J, Chu Q, Ma Y, Li B. Nat Commun. 2022 Nov 17;13(1):7031. doi: 10.1038/s41467-022-34850-0. 10.1038/s41467-022-34850-0 PubMed 36396642