Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

EcSTH-LbNOX
(Plasmid #211924)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 211924 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLVX-TRE3G-IRES-Vector
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EcSTH-LbNOX
  • Species
    Synthetic
  • Insert Size (bp)
    2850
  • Tag / Fusion Protein
    • 3xFLAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GATAGAGAACGTATGTCGAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

We recommend cloning this cDNA into an inducible expression vector system for expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EcSTH-LbNOX was a gift from Binghui Li (Addgene plasmid # 211924 ; http://n2t.net/addgene:211924 ; RRID:Addgene_211924)
  • For your References section:

    Identification of purine biosynthesis as an NADH-sensing pathway to mediate energy stress. Yang R, Yang C, Ma L, Zhao Y, Guo Z, Niu J, Chu Q, Ma Y, Li B. Nat Commun. 2022 Nov 17;13(1):7031. doi: 10.1038/s41467-022-34850-0. 10.1038/s41467-022-34850-0 PubMed 36396642
Commonly requested with: