pALS3-Ma-SUMO-TAG35-sfGFP
(Plasmid
#212120)
-
PurposeFluorescence plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses SUMO-TAG35-sfGFP and M. alvus Pyl-tRNA(6). p15a origin. Tetracycline resistance.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212120 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepALS3
- Backbone size w/o insert (bp) 4807
- Total vector size (bp) 5551
-
Modifications to backboneTetracycline Resistance Marker Added
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameSUMO-TAG35-sfGFP
-
Insert Size (bp)1026
-
MutationE35TAG (within SUMO encoding sequence)
- Promoter araC
-
Tags
/ Fusion Proteins
- His6 (C terminal on insert)
- SUMO-TAG35 (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameM. alvus Pyl-tRNA
-
SpeciesMethanomethylophilus alvus
-
Insert Size (bp)75
- Promoter lpp
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer TTCTGTTGCCCGTCTCACTGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid encodes expression of a) SUMO-sfGFP with an amber (TAG) codon at E35 within the SUMO coding region and b) Methanomethylophilus alvus tRNA(6). It is to be paired with a plasmid that expresses an M. alvus pyrrolysyl-tRNA synthetase (MaRS). This plasmid is used during fluorescence-based selection and characterization of one or more MaRS mutants. It is distinguished from the previous Ma version by containing a tetracycline efflux marker. The SUMO linker is included in order to distance the TAG site from sfGFP.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pALS3-Ma-SUMO-TAG35-sfGFP was a gift from Ryan Mehl (Addgene plasmid # 212120 ; http://n2t.net/addgene:212120 ; RRID:Addgene_212120)