pLX_TRC311/NLS-Cas13d-P2A-Blast
(Plasmid
#212196)
-
PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-Blasticidin for RNA targeting. CasRx-2A-Blasticidin is driven by EF1a promoter. EGFP is driven by SV40
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212196 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLX_TRC311
-
Backbone manufacturerGenetic Perturbation Platform
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCasRx (NLS-RfxCas13d-NLS)-HA with 2A-Blasticidin
-
Alt nameCas13d
-
SpeciesH. sapiens (human); Ruminococcus flavefaciens XPD3002
-
Insert Size (bp)2994
- Promoter EF-1α promoter
-
Tags
/ Fusion Proteins
- HA (C terminal on insert)
- NLS (N terminal on insert)
- NLS (C terminal on insert)
- blasticidin S deaminase (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NdeI (not destroyed)
- 5′ sequencing primer ATTCTCAAGCCTCAGACAGTGG
- 3′ sequencing primer GCCCCTGTTCTCATTTCCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX_TRC311/NLS-Cas13d-P2A-Blast was a gift from Stacey Edwards (Addgene plasmid # 212196 ; http://n2t.net/addgene:212196 ; RRID:Addgene_212196) -
For your References section:
CRISPR-Cas13d screens identify KILR, a breast cancer risk-associated lncRNA that regulates DNA replication and repair. Wang L, Bitar M, Lu X, Jacquelin S, Nair S, Sivakumaran H, Hillman KM, Kaufmann S, Ziegman R, Casciello F, Gowda H, Rosenbluh J, Edwards SL, French JD. Mol Cancer. 2024 May 15;23(1):101. doi: 10.1186/s12943-024-02021-y. 10.1186/s12943-024-02021-y PubMed 38745269