TALED_Left-ND6-1397N
(Plasmid
#212952)
-
PurposeExpresses TALED_Left-ND6-1397N in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 212952 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV
- Total vector size (bp) 6477
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTALED_Left-ND6-1397N
-
SpeciesSynthetic
-
Insert Size (bp)2751
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TALED_Left-ND6-1397N was a gift from Jin-Soo Kim (Addgene plasmid # 212952 ; http://n2t.net/addgene:212952 ; RRID:Addgene_212952) -
For your References section:
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNA. Cho SI, Lim K, Hong S, Lee J, Kim A, Lim CJ, Ryou S, Lee JM, Mok YG, Chung E, Kim S, Han S, Cho SM, Kim J, Kim EK, Nam KH, Oh Y, Choi M, An TH, Oh KJ, Lee S, Lee H, Kim JS. Cell. 2024 Jan 4;187(1):95-109.e26. doi: 10.1016/j.cell.2023.11.035. 10.1016/j.cell.2023.11.035 PubMed 38181745