pLKO5.U6.DR130(CasRX)_Empty.EFS.tRFP657
(Plasmid
#212961)
-
PurposeLentiviral plasmid for the cloning of mature gRNAs of the RfxCas13d (CasRx) CRISPR system. As a marker, the plasmid also encodes the tRFP657 fluorescence protein.
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212961 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLKO.005
- Total vector size (bp) 7347
-
Modifications to backboneSubstitution of the Cas9 sgRNA backbone for a DR1 30 CasRx backbone
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersTagRFP657
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDR1_CasRx_backbone
-
gRNA/shRNA sequenceEmpty
- Promoter U6
-
Tag
/ Fusion Protein
- TagRFP657
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
- 3′ cloning site BsmBI (unknown if destroyed)
- 5′ sequencing primer ACGATACAAGGCTGTTAGAGAG
- 3′ sequencing primer N/A
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO5.U6.DR130(CasRX)_Empty.EFS.tRFP657 was a gift from Roland Rad (Addgene plasmid # 212961 ; http://n2t.net/addgene:212961 ; RRID:Addgene_212961) -
For your References section:
Genome-scale pan-cancer interrogation of lncRNA dependencies using CasRx. Montero JJ, Trozzo R, Sugden M, Ollinger R, Belka A, Zhigalova E, Waetzig P, Engleitner T, Schmidt-Supprian M, Saur D, Rad R. Nat Methods. 2024 Feb 26. doi: 10.1038/s41592-024-02190-0. 10.1038/s41592-024-02190-0 PubMed 38409225