pLKO5.U6.DR130(CasRX)_Empty.EFS.tRFP657
(Plasmid #212961)

• Purpose: Lentiviral plasmid for the cloning of mature gRNAs of the RfxCas13d (CasRx) CRISPR system. As a marker, the plasmid also encodes the tRFP657 fluorescence protein.
• Depositing Lab: Roland Rad
• Publication: Montero et al Nat Methods. 2024 Feb 26. doi: 10.1038/s41592-024-02190-0.

Backbone

• Vector backbone: pLKO.005
• Total vector size (bp): 7347
• Modifications to backbone: Substitution of the Cas9 sgRNA backbone for a DR1 30 CasRx backbone
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: TagRFP657

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DR1_CasRx_backbone
• gRNA/shRNA sequence: Empty
• Promoter: U6
• Tag / Fusion Protein:
  • TagRFP657

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (unknown if destroyed)
• 3′ cloning site: BsmBI (unknown if destroyed)
• 5′ sequencing primer: ACGATACAAGGCTGTTAGAGAG
• 3′ sequencing primer: N/A

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry