myc-tagged NRP1 (human)
(Plasmid
#213068)
-
PurposeExpress myc-NRP1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213068 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1 Hygro
- Backbone size w/o insert (bp) 5597
- Total vector size (bp) 8397
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameneuropilin 1
-
Alt nameNRP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2801
-
MutationN-terminal myc tag was introduced by a three-step PCR procedure
-
GenBank IDnc_000010.11
-
Entrez GeneNRP1 (a.k.a. BDCA4, CD304, NP1, NRP, VEGF165R)
- Promoter T7
-
Tag
/ Fusion Protein
- Myc (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer 5'-GAACAAAAACTCATCTCAGAAGAGGATCTG-3'
- 3′ sequencing primer 5'-CAGATCCTCTTCTGAGATGAGTTTTTGTTC-3'
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe plasmid with the gene encoding NRP1 was obtained from Prof. Gera Neufeld, Technion, Israel. We have inserted an N-terminal myc tag.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To generate the myc-NRP1, a three-step PCR procedure was employed. The first reaction used the T7 promoter primer and a reverse primer recognizing part of the myc tag sequence 5'- GGCGCTTTCGCGAACAAAAACTC -3'. The second reaction employed a forward primer recognizing the rest of the myc tag 5'- ATCTCAGAAGAGGATCTGAACGATAAATGTGGC-3' and a reverse primer recognizing the region encoding the C terminus of NRP1 5'- TATTCG GAGGCATGA CTCGAGGGG -3' . The third reaction used the above two PCR products as a template, using 5'- GAA CAA AAA CTC ATC TCA GAA GAG GAT CTG-3' as a forward primer and its complementary as a reverse primer, and generated one product containing NRP1 with myc tag inserted after nucleotide 23. The final PCR product was digested with BamHI and XhoI and inserted into pcDNA3.1 Hygro digested similarly.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
myc-tagged NRP1 (human) was a gift from Yoav Henis (Addgene plasmid # 213068 ; http://n2t.net/addgene:213068 ; RRID:Addgene_213068)