Skip to main content

myc-tagged NRP1 (human)
(Plasmid #213068)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213068 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1 Hygro
  • Backbone size w/o insert (bp) 5597
  • Total vector size (bp) 8397
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    neuropilin 1
  • Alt name
    NRP1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2801
  • Mutation
    N-terminal myc tag was introduced by a three-step PCR procedure
  • GenBank ID
    nc_000010.11
  • Entrez Gene
    NRP1 (a.k.a. BDCA4, CD304, NP1, NRP, VEGF165R)
  • Promoter T7
  • Tag / Fusion Protein
    • Myc (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer 5'-GAACAAAAACTCATCTCAGAAGAGGATCTG-3'
  • 3′ sequencing primer 5'-CAGATCCTCTTCTGAGATGAGTTTTTGTTC-3'
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The plasmid with the gene encoding NRP1 was obtained from Prof. Gera Neufeld, Technion, Israel. We have inserted an N-terminal myc tag.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

To generate the myc-NRP1, a three-step PCR procedure was employed. The first reaction used the T7 promoter primer and a reverse primer recognizing part of the myc tag sequence 5'- GGCGCTTTCGCGAACAAAAACTC -3'. The second reaction employed a forward primer recognizing the rest of the myc tag 5'- ATCTCAGAAGAGGATCTGAACGATAAATGTGGC-3' and a reverse primer recognizing the region encoding the C terminus of NRP1 5'- TATTCG GAGGCATGA CTCGAGGGG -3' . The third reaction used the above two PCR products as a template, using 5'- GAA CAA AAA CTC ATC TCA GAA GAG GAT CTG-3' as a forward primer and its complementary as a reverse primer, and generated one product containing NRP1 with myc tag inserted after nucleotide 23. The final PCR product was digested with BamHI and XhoI and inserted into pcDNA3.1 Hygro digested similarly.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    myc-tagged NRP1 (human) was a gift from Yoav Henis (Addgene plasmid # 213068 ; http://n2t.net/addgene:213068 ; RRID:Addgene_213068)