pAAV-pTH-iCre-WPREpA
(Plasmid
#213130)
-
PurposeTruncated rat TH promoter expressing iCre
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213130 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerOwn plasmid
- Backbone size w/o insert (bp) 4590
- Total vector size (bp) 6366
-
Vector typeMammalian Expression, Mouse Targeting, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiCre
-
Alt nameCodon-optimized Cre
-
Insert Size (bp)1056
- Promoter Truncated TH promoter from rat (Rattus norvegicus tyrosine hydroxylase promoter region)
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer NA
- 3′ sequencing primer TCCCTCACATCCTCAGGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The promoter is further characterized in Støier et al., Amphetamine-induced reverse transport of dopamine does not require cytosolic Ca2+. J Biol Chem. 2023 Aug;299(8):105063. doi: 10.1016/j.jbc.2023.105063.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-pTH-iCre-WPREpA was a gift from Ulrik Gether (Addgene plasmid # 213130 ; http://n2t.net/addgene:213130 ; RRID:Addgene_213130) -
For your References section:
Nanoscopic dopamine transporter distribution and conformation are inversely regulated by excitatory drive and D2 autoreceptor activity. Lycas MD, Ejdrup AL, Sorensen AT, Haahr NO, Jorgensen SH, Guthrie DA, Stoier JF, Werner C, Newman AH, Sauer M, Herborg F, Gether U. Cell Rep. 2022 Sep 27;40(13):111431. doi: 10.1016/j.celrep.2022.111431. 10.1016/j.celrep.2022.111431 PubMed 36170827