pAAV-pTH-iCre-WPREpA
(Plasmid #213130)

• Purpose: Truncated rat TH promoter expressing iCre
• Depositing Lab: Ulrik Gether
• Publication: Lycas et al Cell Rep. 2022 Sep 27;40(13):111431. doi: 10.1016/j.celrep.2022.111431.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Own plasmid
• Backbone size w/o insert (bp): 4590
• Total vector size (bp): 6366
• Vector type: Mammalian Expression, Mouse Targeting, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: iCre
• Alt name: Codon-optimized Cre
• Insert Size (bp): 1056
• Promoter: Truncated TH promoter from rat (Rattus norvegicus tyrosine hydroxylase promoter region)
• Tag / Fusion Protein:
  • None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: NA
• 3′ sequencing primer: TCCCTCACATCCTCAGGTTC

Resource Information

• Supplemental Documents:
  • pAAV-pTH-iCre-WPREpA.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The promoter is further characterized in Støier et al., Amphetamine-induced reverse transport of dopamine does not require cytosolic Ca2+. J Biol Chem. 2023 Aug;299(8):105063. doi: 10.1016/j.jbc.2023.105063.