Skip to main content

pAAV-pTH-iCre-WPREpA
(Plasmid #213130)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213130 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Own plasmid
  • Backbone size w/o insert (bp) 4590
  • Total vector size (bp) 6366
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    iCre
  • Alt name
    Codon-optimized Cre
  • Insert Size (bp)
    1056
  • Promoter Truncated TH promoter from rat (Rattus norvegicus tyrosine hydroxylase promoter region)
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer NA
  • 3′ sequencing primer TCCCTCACATCCTCAGGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The promoter is further characterized in Støier et al., Amphetamine-induced reverse transport of dopamine does not require cytosolic Ca2+. J Biol Chem. 2023 Aug;299(8):105063. doi: 10.1016/j.jbc.2023.105063.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-pTH-iCre-WPREpA was a gift from Ulrik Gether (Addgene plasmid # 213130 ; http://n2t.net/addgene:213130 ; RRID:Addgene_213130)
  • For your References section:

    Nanoscopic dopamine transporter distribution and conformation are inversely regulated by excitatory drive and D2 autoreceptor activity. Lycas MD, Ejdrup AL, Sorensen AT, Haahr NO, Jorgensen SH, Guthrie DA, Stoier JF, Werner C, Newman AH, Sauer M, Herborg F, Gether U. Cell Rep. 2022 Sep 27;40(13):111431. doi: 10.1016/j.celrep.2022.111431. 10.1016/j.celrep.2022.111431 PubMed 36170827