Skip to main content

CLAPon
(Plasmid #213405)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213405 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 3793
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    E5-TEVcs-APEX(201-250)-K5-EGFP-APEX(2-200)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1785
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAACAGATGGCTGGCAACTAGAAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CLAPon was a gift from Wenjing Wang (Addgene plasmid # 213405 ; http://n2t.net/addgene:213405 ; RRID:Addgene_213405)
  • For your References section:

    Modular Peroxidase-Based Reporters for Detecting Protease Activity and Protein Interactions with Temporal Gating. Zhou G, Wan WW, Wang W. J Am Chem Soc. 2022 Dec 21;144(50):22933-22940. doi: 10.1021/jacs.2c08280. Epub 2022 Dec 13. 10.1021/jacs.2c08280 PubMed 36511757