Ca-LiPPI-CLAPon1.0 (APEX)
(Plasmid
#213408)
-
PurposeLight-gated peroxidase (APEX) reporter for detecting calcium-dependent CaM and MK2 interaction (component 1)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213408 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLX208
- Backbone size w/o insert (bp) 6769
-
Modifications to backboneno Hygromycin
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMK2-E5-truncated hlov-TEVcs-APEX(201-250)-K5-HA-HA-APEX(2-200)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1674
- Promoter CMV
-
Tag
/ Fusion Protein
- HA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site MluI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ca-LiPPI-CLAPon1.0 (APEX) was a gift from Wenjing Wang (Addgene plasmid # 213408 ; http://n2t.net/addgene:213408 ; RRID:Addgene_213408) -
For your References section:
Modular Peroxidase-Based Reporters for Detecting Protease Activity and Protein Interactions with Temporal Gating. Zhou G, Wan WW, Wang W. J Am Chem Soc. 2022 Dec 21;144(50):22933-22940. doi: 10.1021/jacs.2c08280. Epub 2022 Dec 13. 10.1021/jacs.2c08280 PubMed 36511757