Skip to main content

TERT - WT
(Plasmid #213827)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213827 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcW57.1
  • Backbone size w/o insert (bp) 7705
  • Total vector size (bp) 11104
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin, HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    human TERT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3399
  • Entrez Gene
    TERT (a.k.a. CMM9, DKCA2, DKCB4, EST2, PFBMFT1, TCS1, TP2, TRT, hEST2, hTRT)
  • Promoter Tet-responsive promoter PTight, consisting of seven tet operator sequences followed by the minimal CMV promoter

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CAGTGCCTGGTGTGCGTG
  • 3′ sequencing primer CTCCCTGACGCTATGGTTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TERT - WT was a gift from Coleman Lindsley (Addgene plasmid # 213827 ; http://n2t.net/addgene:213827 ; RRID:Addgene_213827)
  • For your References section:

    The clinical and functional effects of TERT variants in myelodysplastic syndrome. Reilly CR, Myllymaki M, Redd R, Padmanaban S, Karunakaran D, Tesmer V, Tsai FD, Gibson CJ, Rana HQ, Zhong L, Saber W, Spellman SR, Hu ZH, Orr EH, Chen MM, De Vivo I, DeAngelo DJ, Cutler C, Antin JH, Neuberg D, Garber JE, Nandakumar J, Agarwal S, Lindsley RC. Blood. 2021 Sep 9;138(10):898-911. doi: 10.1182/blood.2021011075. 10.1182/blood.2021011075 PubMed 34019641