TERT - R865C
(Plasmid
#213926)
-
PurposeExpresses Mutant TERT R865C
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213926 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcW57.1
- Backbone size w/o insert (bp) 3399
- Total vector size (bp) 11104
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMutant TERT R865C
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3399
-
MutationArginine 865 changed to Cysteine
-
Entrez GeneTERT (a.k.a. CMM9, DKCA2, DKCB4, EST2, PFBMFT1, TCS1, TP2, TRT, hEST2, hTRT)
- Promoter Tet-responsive promoter PTight, consisting of seven tet operator sequences followed by the minimal CMV promoter
-
Tag
/ Fusion Protein
- 6x His Tag
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CAGTGCCTGGTGTGCGTG
- 3′ sequencing primer CTCCCTGACGCTATGGTTCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TERT - R865C was a gift from Coleman Lindsley (Addgene plasmid # 213926 ; http://n2t.net/addgene:213926 ; RRID:Addgene_213926) -
For your References section:
The clinical and functional effects of TERT variants in myelodysplastic syndrome. Reilly CR, Myllymaki M, Redd R, Padmanaban S, Karunakaran D, Tesmer V, Tsai FD, Gibson CJ, Rana HQ, Zhong L, Saber W, Spellman SR, Hu ZH, Orr EH, Chen MM, De Vivo I, DeAngelo DJ, Cutler C, Antin JH, Neuberg D, Garber JE, Nandakumar J, Agarwal S, Lindsley RC. Blood. 2021 Sep 9;138(10):898-911. doi: 10.1182/blood.2021011075. 10.1182/blood.2021011075 PubMed 34019641