Skip to main content

pAAV-hsyn-DIO-Rpl22l1-3Flag-2A-eGFP-WPRE
(Plasmid #214265)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214265 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pFB
  • Backbone manufacturer
    Virovek
  • Backbone size w/o insert (bp) 4825
  • Total vector size (bp) 8009
  • Modifications to backbone
    N/A
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Flag-tagged Rpl22I1 protein expressing Cre Recombinase
  • Alt name
    Ribosomal protein L22-like1
  • Alt name
    RPL22L1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3184
  • Mutation
    N/A
  • GenBank ID
    NM_001347226.3
  • Entrez Gene
    Rpl22 (a.k.a. 2700038K18Rik)
  • Promoter Synapsin
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CCCAGCCGGACCGCACCACGC
  • 3′ sequencing primer GGCGATACTCACATTCAGAACC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ORF clone purchased from Origene cat # MR200606

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hsyn-DIO-Rpl22l1-3Flag-2A-eGFP-WPRE was a gift from D. James Surmeier (Addgene plasmid # 214265 ; http://n2t.net/addgene:214265 ; RRID:Addgene_214265)