Skip to main content
Addgene

pMK444 (EF1-OsTIR1(F74G) Puro)
(Plasmid #214374)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214374 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMK443 (PiggyBac EF1-MCS-Puro)
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EF1-OsTIR1(F74G)
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Promoter EF1 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer cactgagtgggtggagactg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Use this donor plasmid with a PiggyBac transposase encoding plasmid for making stable cell lines.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMK444 (EF1-OsTIR1(F74G) Puro) was a gift from Masato Kanemaki (Addgene plasmid # 214374 ; http://n2t.net/addgene:214374 ; RRID:Addgene_214374)
  • For your References section:

    Combination of AID2 and BromoTag expands the utility of degron-based protein knockdowns. Hatoyama Y, Islam M, Bond AG, Hayashi KI, Ciulli A, Kanemaki MT. EMBO Rep. 2024 Sep;25(9):4062-4077. doi: 10.1038/s44319-024-00224-4. Epub 2024 Aug 23. 10.1038/s44319-024-00224-4 PubMed 39179892