pMK444 (EF1-OsTIR1(F74G) Puro)
(Plasmid
#214374)
-
PurposeEF1-OsTIR1(F74G) (PiggyBac)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214374 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMK443 (PiggyBac EF1-MCS-Puro)
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEF1-OsTIR1(F74G)
-
SpeciesH. sapiens (human), M. musculus (mouse)
- Promoter EF1 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer cactgagtgggtggagactg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Use this donor plasmid with a PiggyBac transposase encoding plasmid for making stable cell lines.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMK444 (EF1-OsTIR1(F74G) Puro) was a gift from Masato Kanemaki (Addgene plasmid # 214374 ; http://n2t.net/addgene:214374 ; RRID:Addgene_214374) -
For your References section:
Combination of AID2 and BromoTag expands the utility of degron-based protein knockdowns. Hatoyama Y, Islam M, Bond AG, Hayashi KI, Ciulli A, Kanemaki MT. EMBO Rep. 2024 Sep;25(9):4062-4077. doi: 10.1038/s44319-024-00224-4. Epub 2024 Aug 23. 10.1038/s44319-024-00224-4 PubMed 39179892