KIF5A-GFP-SspB
(Plasmid
#214401)
-
PurposeExpresses fusion of Kinesin heavy chain 5A (1-572) with GFP and SspB (micro)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214401 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFPN1
- Backbone size w/o insert (bp) 4733
- Total vector size (bp) 6790
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKIF5A-GFP-SspB
-
Alt nameKif5a
-
SpeciesR. norvegicus (rat), Synthetic
-
Insert Size (bp)2844
-
Entrez GeneKif5a
- Promoter CMV
-
Tag
/ Fusion Protein
- KIF5A-GFP-SspB (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer CCTCTACAAATGTGGTATGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.10.27.513965v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
KIF5A-GFP-SspB was a gift from Liting Duan (Addgene plasmid # 214401 ; http://n2t.net/addgene:214401 ; RRID:Addgene_214401) -
For your References section:
Force-induced tail-autotomy mitochondrial fission and biogenesis of matrix-excluded mitochondrial-derived vesicles for quality control. Liu X, Xu L, Song Y, Zhao Z, Li X, Wong CY, Chen R, Feng J, Gou Y, Qi Y, Chow HM, Yao S, Wang Y, Gao S, Liu X, Duan L. Proc Natl Acad Sci U S A. 2024 Apr 2;121(14):e2217019121. doi: 10.1073/pnas.2217019121. Epub 2024 Mar 28. 10.1073/pnas.2217019121 PubMed 38547062