pMIA22
              
              
                (Plasmid
                
                #214448)
              
            
            
            
          - 
            PurposeExpresses BxbI-BP-NLS
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214448 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepMAX-GFP
 - 
              Backbone manufacturerLonza
 - 
              Vector typeMammalian Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameBxbI
 - 
                    SpeciesSynthetic
 - 
                  Insert Size (bp)1500
 - Promoter CMV
 - 
    
        Tag
        / Fusion Protein
    
- BP-NLS (C terminal on insert)
 
 
Cloning Information
- Cloning method Gibson Cloning
 - 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pMIA22 was a gift from Roger Foo (Addgene plasmid # 214448 ; http://n2t.net/addgene:214448 ; RRID:Addgene_214448) - 
                
For your References section:
Computationally defined and in vitro validated putative genomic safe harbour loci for transgene expression in human cells. Autio MI, Motakis E, Perrin A, Bin Amin T, Tiang Z, Do DV, Wang J, Tan JKM, Ding SSL, Tan WX, Lee CJM, Teo AKK, Foo R. Elife. 2024 Jan 2;13:e79592. doi: 10.7554/eLife.79592. 10.7554/eLife.79592 PubMed 38164941