Skip to main content
Addgene

#1.4 post-G-SynapShot-mScarlet
(Plasmid #214716)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214716 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG
  • Total vector size (bp) 9394
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    #1.4 post-G-SynapShot
  • Species
    Synthetic
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTACAGCTCCTGGGCAACGTGC
  • 3′ sequencing primer caaggggcttcatgatgtcc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    #1.4 post-G-SynapShot-mScarlet was a gift from Won Do Heo (Addgene plasmid # 214716 ; http://n2t.net/addgene:214716 ; RRID:Addgene_214716)
  • For your References section:

    Real-time visualization of structural dynamics of synapses in live cells in vivo. Son S, Nagahama K, Lee J, Jung K, Kwak C, Kim J, Noh YW, Kim E, Lee S, Kwon HB, Heo WD. Nat Methods. 2024 Jan 8. doi: 10.1038/s41592-023-02122-4. 10.1038/s41592-023-02122-4 PubMed 38191933