#1.4 post-R-SynapShot-Lyn-miRFP670
(Plasmid
#214718)
-
PurposeExpresses red #1.4 post-SynapShot and Lyn-miRFP670
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214718 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAG
- Total vector size (bp) 9651
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name#1.4 post-R-SynapShot
-
SpeciesSynthetic
- Promoter CAG
-
Tag
/ Fusion Protein
- Lyn-miRFP670 (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CTACAGCTCCTGGGCAACGTGC
- 3′ sequencing primer TGATAGACACAAAAAATTCCAACACAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
#1.4 post-R-SynapShot-Lyn-miRFP670 was a gift from Won Do Heo (Addgene plasmid # 214718 ; http://n2t.net/addgene:214718 ; RRID:Addgene_214718) -
For your References section:
Real-time visualization of structural dynamics of synapses in live cells in vivo. Son S, Nagahama K, Lee J, Jung K, Kwak C, Kim J, Noh YW, Kim E, Lee S, Kwon HB, Heo WD. Nat Methods. 2024 Jan 8. doi: 10.1038/s41592-023-02122-4. 10.1038/s41592-023-02122-4 PubMed 38191933