-
PurposeThis plasmid encodes a protein (SPYtag-Histag-Avidin) that is used for generating functionalized magnetic beads for MagIC-cryo-EM, a method for single-particle cryo-EM analysis on magnetic beads.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214836 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET21a
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSPYtag-Histag-Avidin
-
SpeciesStreptomyces avidinii
- Promoter T7
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer GGAGATATACATATGCGTGGTGTTCCG
- 3′ sequencing primer GATACCAGCTTCAGCAGAACC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.01.21.576499 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SPYtag-Histag-Avidin was a gift from Hironori Funabiki (Addgene plasmid # 214836 ; http://n2t.net/addgene:214836 ; RRID:Addgene_214836) -
For your References section:
MagIC-Cryo-EM: Structural determination on magnetic beads for scarce macromolecules in heterogeneous samples. Arimura Y, Konishi HA, Funabiki H. bioRxiv 2024.01.21.576499. 10.1101/2024.01.21.576499