-
PurposeThis plasmid encodes a protein (Cys-3HB-SPYcatcher) that is used for generating functionalized magnetic beads for MagIC-cryo-EM, a method for single-particle cryo-EM analysis on magnetic beads.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214838 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepQE80
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCys-3HB-SPYcatcher
-
SpeciesSynthetic
- Promoter T5
-
Tag
/ Fusion Protein
- His-TEV-SUMO- (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGGATTCTCACCAATAAAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.01.21.576499 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cys-3HB-SPYcatcher was a gift from Hironori Funabiki (Addgene plasmid # 214838 ; http://n2t.net/addgene:214838 ; RRID:Addgene_214838) -
For your References section:
MagIC-Cryo-EM, structural determination on magnetic beads for scarce macromolecules in heterogeneous samples. Arimura Y, Konishi HA, Funabiki H. eLife. 2025 May 20;13:RP103486. doi: 10.7554/eLife.103486. 10.7554/eLife.103486 PubMed 40390365