PGL3-MK17
(Plasmid
#21486)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21486 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePGL3 Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4800
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCited2 Promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3440
-
GenBank IDAF129290
-
Entrez GeneCITED2 (a.k.a. ASD8, MRG-1, MRG1, P35SRJ, VSD2)
-
Tag
/ Fusion Protein
- Luciferase (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site kpnI (not destroyed)
- 3′ cloning site xhoI (not destroyed)
- 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
- 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCCA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Contains bases -3375 to +65 of cited2 genomic sequence. Constructed by cloning a 2.8kb KpnI/AvrII genomic fragment into the MK14 plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PGL3-MK17 was a gift from Shoumo Bhattacharya (Addgene plasmid # 21486 ; http://n2t.net/addgene:21486 ; RRID:Addgene_21486) -
For your References section:
Molecular cloning and chromosomal localization of the human CITED2 gene encoding p35srj/Mrg1. Leung MK, Jones T, Michels CL, Livingston DM, Bhattacharya S. Genomics. 1999 Nov 1. 61(3):307-13. 10.1006/geno.1999.5970 PubMed 10552932
Map uploaded by the depositor.