12URA-B-ScTop2∆CTD
(Plasmid
#214924)
-
PurposeYeast expression vector 6xHisTag-TEV at N terminus to express S cerevisiae topoisomerase II (1–1177)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214924 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbone12URA-B
-
Backbone manufacturerMacroLab
- Backbone size w/o insert (bp) 7999
- Total vector size (bp) 11527
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametopoisomerase II
-
Alt nameTOP2
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)3528
-
MutationDeleted amino acids 1178-1428
-
GenBank IDM13814.1
- Promoter Gal 1/10
-
Tag
/ Fusion Protein
- 6x His-TEV (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGCATAACCACTTTAACTAATAC
- 3′ sequencing primer GTAAATGCATGTATACTAAACTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byMacroLab (12URA-B ), available through Addgene (https://www.addgene.org/48304/). Cloned by Bryan H Schmidt, James Berger lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
12URA-B-ScTop2∆CTD was a gift from James Berger (Addgene plasmid # 214924 ; http://n2t.net/addgene:214924 ; RRID:Addgene_214924) -
For your References section:
DNA-Stimulated Liquid-Liquid phase separation by eukaryotic topoisomerase ii modulates catalytic function. Jeong J, Lee JH, Carcamo CC, Parker MW, Berger JM. Elife. 2022 Nov 7;11:e81786. doi: 10.7554/eLife.81786. 10.7554/eLife.81786 PubMed 36342377