hTMEM115-TEV-3xHA-P2A-mScarlet HDR template
              
              
                (Plasmid
                
                #214998)
              
            
            
            
          - 
            PurposeEndogenously tag human TMEM115 with a C-terminal 3xHA tag in addition to cytosolic mScarlet-I for cell sorting.
 - 
              Depositing Lab
 - 
          Publication
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214998 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepTwist-Amp
 - 
              Vector typeHDR template
 - 
                Selectable markersmScarlet-I
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert namehTMEM115-TEV-3xHA-P2A-mScarlet HDR template
 - 
                    SpeciesH. sapiens (human)
 - 
                        Entrez GeneTMEM115 (a.k.a. PL6)
 - Promoter None
 - 
    
        Tag
        / Fusion Protein
    
- 3xHA (C terminal on insert)
 
 
Cloning Information
- Cloning method Unknown
 - 5′ sequencing primer Unknown (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
Depositor Comments
Use either of the following guides: GTCTGGAGTTACAGCGTCGGGGG or CCGCTCATTGAGTGCCTTCAGGG (in both cases, the PAM is the final GGG) . Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
hTMEM115-TEV-3xHA-P2A-mScarlet HDR template was a gift from Wade Harper (Addgene plasmid # 214998 ; http://n2t.net/addgene:214998 ; RRID:Addgene_214998) - 
                
For your References section:
Spatiotemporal proteomic profiling of cellular responses to NLRP3 agonists. Hollingsworth LR, Veeraraghavan P, Paulo JA, Harper JW. bioRxiv 2024.04.19.590338 10.1101/2024.04.19.590338