pWN172
(Plasmid
#215291)
-
PurposeExpresses sfGFP under the Anderson J23113 promoter with an RSF1010 backbone.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 215291 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneRSF1010
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 5808
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesfGFP
-
SpeciesSynthetic
-
Insert Size (bp)711
- Promoter J23113
-
Tag
/ Fusion Protein
- His (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer agaacctgcgtgcaatccatc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWN172 was a gift from Brian Pfleger (Addgene plasmid # 215291 ; http://n2t.net/addgene:215291 ; RRID:Addgene_215291) -
For your References section:
Synthetic Biology Toolbox for Nitrogen-Fixing Soil Microbes. Venkataraman M, Ynigez-Gutierrez A, Infante V, MacIntyre A, Fernandes-Junior PI, Ane JM, Pfleger B. ACS Synth Biol. 2023 Dec 15;12(12):3623-3634. doi: 10.1021/acssynbio.3c00414. Epub 2023 Nov 21. 10.1021/acssynbio.3c00414 PubMed 37988619