punc-119cR
(Plasmid
#21596)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21596 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneR6K origin PCR fragment
-
Backbone manufacturerEpicentre
- Backbone size w/o insert (bp) 300
-
Vector typeWorm Expression ; Adds unc-119 marker to Amp resistant plasmids
-
Selectable markersunc-119, mCherry
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir116
-
Growth instructionsRequires pir expressing bacterial strain such as EC100 pir-116
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameunc-119:mCherry
-
Alt namekanamycin resistance
-
Alt namemCherry
-
Alt nameunc-119
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)3200
-
MutationN/A
-
GenBank IDNM_066998
-
Entrez Geneunc-119 (a.k.a. CELE_M142.1)
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHi (not destroyed)
- 5′ sequencing primer GCACTTTTCGGGGAAATGTGC
- 3′ sequencing primer GGTCTGACAGTTACCAATGCTTAATC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe R6K replication origin was generated via PCR from pMOD4 (Epicentre). The kanamycin resistance gene was generated via PCR from pKRP11 (The Cloning Vector collection). The unc-119 gene was subcloned from pCG150 (available from Addgene). The mCherry sequence was generated by PCR from pAA64.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid has small deletions within the KanR gene. We generated these fragments by PCR so it is definitely possible that these were generated during amplification, these changes must not impair function as the construct is Kan resistant both as a plasmid and following recombination.
The other mismatches in 21596 are in a polylinker between the KanR gene and the unc-119 3’ UTR and should not cause any problems.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
punc-119cR was a gift from Al Fisher (Addgene plasmid # 21596 ; http://n2t.net/addgene:21596 ; RRID:Addgene_21596) -
For your References section:
Retrofitting Ampicillin Resistant Vectors by Recombination for use in Generating C. elegans Transgenic Animals by Bombardment. Ferguson AA, Fisher AL. Plasmid. 2009 Jun 8. ():. 10.1016/j.plasmid.2009.06.001 PubMed 19520111