Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

punc-119c
(Plasmid #21595)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21595 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    R6K origin PCR fragment
  • Backbone manufacturer
    Epicentre
  • Backbone size w/o insert (bp) 300
  • Vector type
    Worm Expression ; Adds unc-119 marker to Amp resistant plasmids
  • Selectable markers
    unc-119

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir116
  • Growth instructions
    Requires pir expressing bacterial strain such as EC100 pir-116
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    unc-119
  • Alt name
    kanamycin resistance
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    3200
  • Mutation
    N/A
  • GenBank ID
    NM_066998
  • Entrez Gene
    unc-119 (a.k.a. CELE_M142.1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHi (not destroyed)
  • 5′ sequencing primer GCACTTTTCGGGGAAATGTGC
  • 3′ sequencing primer GGTCTGACAGTTACCAATGCTTAATC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The R6K replication origin was generated via PCR from pMOD4 (Epicentre). The kanamycin resistance gene was generated via PCR from pKRP11 (The Cloning Vector collection). The unc-119 gene was subcloned from pCG150 (available from Addgene).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid has small deletions within the KanR gene. We generated these fragments by PCR so it is definitely possible that these were generated during amplification, these changes must not impair function as the construct is Kan resistant both as a plasmid and following recombination.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    punc-119c was a gift from Al Fisher (Addgene plasmid # 21595 ; http://n2t.net/addgene:21595 ; RRID:Addgene_21595)
  • For your References section:

    Retrofitting Ampicillin Resistant Vectors by Recombination for use in Generating C. elegans Transgenic Animals by Bombardment. Ferguson AA, Fisher AL. Plasmid. 2009 Jun 8. ():. 10.1016/j.plasmid.2009.06.001 PubMed 19520111