Skip to main content

punc-119cR
(Plasmid #21596)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21596 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    R6K origin PCR fragment
  • Backbone manufacturer
    Epicentre
  • Backbone size w/o insert (bp) 300
  • Vector type
    Worm Expression ; Adds unc-119 marker to Amp resistant plasmids
  • Selectable markers
    unc-119, mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir116
  • Growth instructions
    Requires pir expressing bacterial strain such as EC100 pir-116
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    unc-119:mCherry
  • Alt name
    kanamycin resistance
  • Alt name
    mCherry
  • Alt name
    unc-119
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    3200
  • Mutation
    N/A
  • GenBank ID
    NM_066998
  • Entrez Gene
    unc-119 (a.k.a. CELE_M142.1)
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHi (not destroyed)
  • 5′ sequencing primer GCACTTTTCGGGGAAATGTGC
  • 3′ sequencing primer GGTCTGACAGTTACCAATGCTTAATC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The R6K replication origin was generated via PCR from pMOD4 (Epicentre). The kanamycin resistance gene was generated via PCR from pKRP11 (The Cloning Vector collection). The unc-119 gene was subcloned from pCG150 (available from Addgene). The mCherry sequence was generated by PCR from pAA64.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid has small deletions within the KanR gene. We generated these fragments by PCR so it is definitely possible that these were generated during amplification, these changes must not impair function as the construct is Kan resistant both as a plasmid and following recombination.

The other mismatches in 21596 are in a polylinker between the KanR gene and the unc-119 3’ UTR and should not cause any problems.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    punc-119cR was a gift from Al Fisher (Addgene plasmid # 21596 ; http://n2t.net/addgene:21596 ; RRID:Addgene_21596)
  • For your References section:

    Retrofitting ampicillin resistant vectors by recombination for use in generating C. elegans transgenic animals by bombardment. Ferguson AA, Fisher AL. Plasmid. 2009 Sep;62(2):140-5. doi: 10.1016/j.plasmid.2009.06.001. Epub 2009 Jun 9. 10.1016/j.plasmid.2009.06.001 PubMed 19520111