pIE2-AD
(Plasmid
#21603)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21603 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepIZT
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4635
-
Vector typeInsect Expression ; Gateway Destination Vector
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Tetracycline, 25 & 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsDB3.1 (Invitrogen) 37°C
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNF-kappa-B p65 subunit
-
Alt namep65
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)681
-
GenBank IDNP_033071
-
Entrez GeneRela (a.k.a. p65, p65 NF-kappa B, p65 NFkB)
-
Tags
/ Fusion Proteins
- NLS (N terminal on backbone)
- Flag (N terminal on backbone)
- Gateway destination cassette (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TTATCGCGCCTATAAATACAGCCCGCAAC
- 3′ sequencing primer CACGCGCTTGAAAGGAGTGTGTAAATGGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIE2-AD was a gift from Takahiro Kusakabe (Addgene plasmid # 21603 ; http://n2t.net/addgene:21603 ; RRID:Addgene_21603) -
For your References section:
Analysis of protein interactions with two-hybrid system in cultured insect cells. Mon H, Sugahara R, Hong SM, Lee JM, Kamachi Y, Kawaguchi Y, Kusakabe T. Anal Biochem. 2009 Sep 15;392(2):180-2. doi: 10.1016/j.ab.2009.05.033. 10.1016/j.ab.2009.05.033 PubMed 19481053