SGLT1(GFP)-MAP17(nb)
(Plasmid
#216210)
-
Purposefor expression of human GFP-tagged SGLT1-MAP17 nanobody complex in BacMam system
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216210 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBM
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cttaattaacaacaccatttg (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SGLT1(GFP)-MAP17(nb) was a gift from Lei Chen (Addgene plasmid # 216210 ; http://n2t.net/addgene:216210 ; RRID:Addgene_216210) -
For your References section:
Structures of human SGLT in the occluded state reveal conformational changes during sugar transport. Cui W, Niu Y, Sun Z, Liu R, Chen L. Nat Commun. 2023 May 22;14(1):2920. doi: 10.1038/s41467-023-38720-1. 10.1038/s41467-023-38720-1 PubMed 37217492