TDP-43 mCerulean
(Plasmid
#216227)
-
PurposeTDP-43 with a C-terminal mCerulean tag for expression in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216227 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
-
Backbone manufacturerNovopro
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 6000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTDP-43
-
Alt nameTransactive response DNA binding protein of 43 kDa
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2028
-
Entrez GeneTARDBP (a.k.a. ALS10, TDP-43)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCerulean
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TDP-43 mCerulean was a gift from Jennifer Lee (Addgene plasmid # 216227 ; http://n2t.net/addgene:216227 ; RRID:Addgene_216227) -
For your References section:
Genetically encoded lysine photocage for spatiotemporal control of TDP-43 nuclear import. Shadish JA, Lee JC. Biophys Chem. 2024 Jan 23;307:107191. doi: 10.1016/j.bpc.2024.107191. 10.1016/j.bpc.2024.107191 PubMed 38290242