pSH-CAG-AtAFB2.F74A-IRES-puro
(Plasmid
#216245)
-
PurposeExpress AtAFB2.F74A mutant without tag for AID2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216245 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSH-CAG-IRES-P
- Backbone size w/o insert (bp) 8200
- Total vector size (bp) 10278
-
Vector typeMammalian Expression, CRISPR, TALEN ; Human safe harbor locus (A AVS1) site-specific integration
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAtAFB2.F74A
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)1725
-
MutationF74A mutation
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer ctcctgggcaacgtgctggt
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDe novo synthesis by Genscript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For AID2 with cvxIAA, 5-PH-IAA or pico_cvxIAA.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSH-CAG-AtAFB2.F74A-IRES-puro was a gift from Elina Ikonen (Addgene plasmid # 216245 ; http://n2t.net/addgene:216245 ; RRID:Addgene_216245) -
For your References section:
HiHo-AID2: boosting homozygous knock-in efficiency enables robust generation of human auxin-inducible degron cells. Li S, Wang Y, van der Stoel M, Zhou X, Madhusudan S, Kanerva K, Nguyen VD, Eskici N, Olkkonen VM, Zhou Y, Raivio T, Ikonen E. Genome Biol. 2024 Feb 26;25(1):58. doi: 10.1186/s13059-024-03187-w. 10.1186/s13059-024-03187-w PubMed 38409044