Skip to main content

pSH-EF1a-OsTIR1.F74A-mCherry-IRES-puro
(Plasmid #216247)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216247 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSH-EFIRES-P
  • Backbone size w/o insert (bp) 8200
  • Total vector size (bp) 10670
  • Vector type
    Mammalian Expression, CRISPR, TALEN ; Human safe harbor locus (A AVS1) site-specific integration
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OsTIR1.F74A
  • Species
    Oryza sativa
  • Insert Size (bp)
    2445
  • Promoter EF1a
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    De novo synthesis from Genscript

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSH-EF1a-OsTIR1.F74A-mCherry-IRES-puro was a gift from Elina Ikonen (Addgene plasmid # 216247 ; http://n2t.net/addgene:216247 ; RRID:Addgene_216247)
  • For your References section:

    HiHo-AID2: boosting homozygous knock-in efficiency enables robust generation of human auxin-inducible degron cells. Li S, Wang Y, van der Stoel M, Zhou X, Madhusudan S, Kanerva K, Nguyen VD, Eskici N, Olkkonen VM, Zhou Y, Raivio T, Ikonen E. Genome Biol. 2024 Feb 26;25(1):58. doi: 10.1186/s13059-024-03187-w. 10.1186/s13059-024-03187-w PubMed 38409044