Skip to main content

pRF+423Dux4
(Plasmid #21625)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21625 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRF
  • Backbone size w/o insert (bp) 6518
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Double homeobox, chr 4
  • Alt name
    Dux4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    423
  • Entrez Gene
    DUX4 (a.k.a. DUX4L)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NcoI (not destroyed)
  • 5′ sequencing primer GCAAGAAGATGCACCTGATG
  • 3′ sequencing primer AGGAACCAGGGCGTATCTCT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRF+423Dux4 was a gift from Stephen Tapscott (Addgene plasmid # 21625 ; http://n2t.net/addgene:21625 ; RRID:Addgene_21625)
  • For your References section:

    RNA transcripts, miRNA-sized fragments and proteins produced from D4Z4 units: new candidates for the pathophysiology of facioscapulohumeral dystrophy. Snider L, Asawachaicharn A, Tyler AE, Geng LN, Petek LM, Maves L, Miller DG, Lemmers RJ, Winokur ST, Tawil R, van der Maarel SM, Filippova GN, Tapscott SJ. Hum Mol Genet. 2009 Jul 1;18(13):2414-30. doi: 10.1093/hmg/ddp180. Epub 2009 Apr 9. 10.1093/hmg/ddp180 PubMed 19359275