pCfB2197-PrGNP1-mK2-NatMX
(Plasmid
#216513)
-
PurposeIntegrative fluorescent reporter for amino acid uptake sensing pathway, comprising mKate2 driven by the GNP1 promoter within the Easy clone vector, requires NotI digestion for integration in yeast
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216513 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCfB2197
-
Backbone manufacturerIrina Borodina Easy Clone 2.0 (Addgene #67551)
- Backbone size w/o insert (bp) 5916
- Total vector size (bp) 7622
-
Modifications to backboneCut with SfaAI (AsiSI) and nicked with Nb.BsmI
-
Vector typeYeast Expression, Cre/Lox ; Integrative
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePrGnp1-mKate2
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1714
- Promoter GNP1
Cloning Information
- Cloning method Other
- 5′ sequencing primer GAAATTCGCTTATTTAGAAGTGTC
- 3′ sequencing primer CTCCTTCCTTTTCGGTTAGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For further details refer to: EasyClone 2.0 Yeast Toolkit (Addgene Kit #1000000073 )
EasyClone 2.0: expanded toolkit of integrative vectors for stable gene expression in industrial Saccharomyces cerevisiae strains. Stovicek V, Borja GM, Forster J, Borodina I. J Ind Microbiol Biotechnol. 2015 Nov;42(11):1519-31. doi: 10.1007/s10295-015-1684-8. Epub 2015 Sep 16.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCfB2197-PrGNP1-mK2-NatMX was a gift from Juha Saarikangas (Addgene plasmid # 216513 ; http://n2t.net/addgene:216513 ; RRID:Addgene_216513) -
For your References section:
A dual reporter system for intracellular and extracellular amino acid sensing in budding yeast. Paukstyte J, Tena EC, Saarikangas J. Mol Biol Cell. 2025 Apr 2:mbcE24040162. doi: 10.1091/mbc.E24-04-0162. 10.1091/mbc.E24-04-0162 PubMed 40172974