Skip to main content

pCfB2197-PrGNP1-mK2-NatMX
(Plasmid #216513)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216513 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCfB2197
  • Backbone manufacturer
    Irina Borodina Easy Clone 2.0 (Addgene #67551)
  • Backbone size w/o insert (bp) 5916
  • Total vector size (bp) 7622
  • Modifications to backbone
    Cut with SfaAI (AsiSI) and nicked with Nb.BsmI
  • Vector type
    Yeast Expression, Cre/Lox ; Integrative
  • Selectable markers
    Nourseothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PrGnp1-mKate2
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1714
  • Promoter GNP1

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer GAAATTCGCTTATTTAGAAGTGTC
  • 3′ sequencing primer CTCCTTCCTTTTCGGTTAGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For further details refer to: EasyClone 2.0 Yeast Toolkit (Addgene Kit #1000000073 )
EasyClone 2.0: expanded toolkit of integrative vectors for stable gene expression in industrial Saccharomyces cerevisiae strains. Stovicek V, Borja GM, Forster J, Borodina I. J Ind Microbiol Biotechnol. 2015 Nov;42(11):1519-31. doi: 10.1007/s10295-015-1684-8. Epub 2015 Sep 16.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCfB2197-PrGNP1-mK2-NatMX was a gift from Juha Saarikangas (Addgene plasmid # 216513 ; http://n2t.net/addgene:216513 ; RRID:Addgene_216513)
  • For your References section:

    A dual reporter system for intracellular and extracellular amino acid sensing in budding yeast. Paukstyte J, Tena EC, Saarikangas J. Mol Biol Cell. 2025 Apr 2:mbcE24040162. doi: 10.1091/mbc.E24-04-0162. 10.1091/mbc.E24-04-0162 PubMed 40172974