pAAV/hSyn-SCLM
(Plasmid
#216760)
-
PurposeAAV2 transfer vector with the human synapsin I promoter for neuronal expression of SuperClomeleon
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 216760 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV Syn ChR E90R-D156N-T159C 2A tDimer
-
Backbone manufacturerThomas Oertner (Addgene plasmid # 52494)
- Backbone size w/o insert (bp) 4690
- Total vector size (bp) 6076
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSuperClomeleon
-
Alt nameCerulean/S30R/dC11-LE-Topaz/dN5/S30R/Q69T/V163A
-
SpeciesA. victoria (crystal jelly)
-
Insert Size (bp)1386
-
MutationS30R and 11 AA deletion in the Cerulean CFP moiety and 5 AA deletion, S30R, Q69T, and V163A in the Topaz YFP moiety
- Promoter hSyn (human synapsin I)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer tgggcagcggaggagtcgt
- 3′ sequencing primer agccatacgggaagcaatagc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Wimmer, R., Schmitt, L., Davidson, T. et al. Thalamic control of sensory selection in divided attention. Nature 526, 705–709 (2015). https://doi.org/10.1038/nature15398
Boffi JC, Knabbe J, Kaiser M and Kuner T (2018) KCC2-dependent Steady-state Intracellular Chloride Concentration and pH in Cortical Layer 2/3 Neurons of Anesthetized and Awake Mice. Front. Cell. Neurosci. 12:7. https://doi.org/10.3389/fncel.2018.00007
Nakajima M, Schmitt LI, Halassa MM. Prefrontal Cortex Regulates Sensory Filtering through a Basal Ganglia-to-Thalamus Pathway. Neuron 103(3), 445-458.e10 (2019). https://doi.org/10.1016/j.neuron.2019.05.026
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV/hSyn-SCLM was a gift from George Augustine (Addgene plasmid # 216760 ; http://n2t.net/addgene:216760 ; RRID:Addgene_216760)