pAcBac1-GFP(39TAG)
(Plasmid
#217360)
-
PurposeExpression of reporter EGFP with a TAG stop codon at 39 aa position; can be packaged into bacmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217360 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAcBac1-EGFP
-
Backbone manufacturerderived from pFastBac-Dual from Invitrogen.
- Backbone size w/o insert (bp) 7942
- Total vector size (bp) 8755
-
Modifications to backbonereplaced eGFP wild type with eGFP-Y39TAG from overlap PCR using restriction enzymes EcoRI and NheI
-
Vector typeMammalian Expression, Insect Expression ; baculoviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Gentamicin, 100 & 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEnhanced green fluorescent protein
-
Alt nameeGFP
-
Alt nameeGFP-Y39TAG
-
Alt nameGFP(39TAG)
-
Insert Size (bp)782
-
MutationY39TAG
-
GenBank ID8382257
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAAGGAGGAGAAAATGAAAGCCATACGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
the 39 amino acid position for Y39TAG is relative to the fully processed eGFP (i.e. the numbering for amino acid position starts after the methionine start codon that is removed from eGFP post-translationally).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAcBac1-GFP(39TAG) was a gift from Abhishek Chatterjee (Addgene plasmid # 217360 ; http://n2t.net/addgene:217360 ; RRID:Addgene_217360) -
For your References section:
Virus-assisted directed evolution of enhanced suppressor tRNAs in mammalian cells. Jewel D, Kelemen RE, Huang RL, Zhu Z, Sundaresh B, Cao X, Malley K, Huang Z, Pasha M, Anthony J, van Opijnen T, Chatterjee A. Nat Methods. 2023 Jan;20(1):95-103. doi: 10.1038/s41592-022-01706-w. Epub 2022 Dec 22. 10.1038/s41592-022-01706-w PubMed 36550276