-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21751 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCR2.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3900
-
Vector typecloning
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemagA
-
SpeciesM. magnetotacticum
-
Insert Size (bp)1300
-
GenBank IDAF257521
-
Entrez GenemagA
Cloning Information
- Cloning method TOPO Cloning
- 5′ cloning site TA (destroyed during cloning)
- 3′ cloning site TA (destroyed during cloning)
- 5′ sequencing primer GAAGACGGCCATCTTCACCA
- 3′ sequencing primer TTCTTCCAGATGAACTTGAA
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The sequence inserted into the pCR2.1 vector is larger than just the magA gene. The magA gene is preceded by 373 bp of genomic DNA and followed by 30 bp of genomic DNA. The gene contains 2 amino acid substitutions - S94L and P390S.
The cloned gene was used primarily as a probe. Also see Zurkiya et al. Magn Reson Med. 2008 Jun;59(6):1225-31.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MS-1 magA was a gift from Elliot Meyerowitz (Addgene plasmid # 21751 ; http://n2t.net/addgene:21751 ; RRID:Addgene_21751) -
For your References section:
Physical and genetic characterization of the genome of Magnetospirillum magnetotacticum, strain MS-1. Bertani LE, Weko J, Phillips KV, Gray RF, Kirschvink JL. Gene. 2001 Feb 21. 264(2):257-63. 10.1016/S0378-1119(01)00331-6 PubMed 11250081