Skip to main content

pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2
(Plasmid #217635)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217635 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-U6- sgRNA-CMV-GFP (Addgene #85451)
  • Backbone manufacturer
    Hetian Lei
  • Backbone size w/o insert (bp) 2904
  • Total vector size (bp) 6016
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mU6-sgRNA, Handle sequence, EF1a-mTagBFP2
  • gRNA/shRNA sequence
    Non-targeting control in mouse genetic background (mNTC194): GGATGCATAGATGAACGGAT
  • Species
    Synthetic; mTagBFP2 derived from Entacmaea quadricolor
  • Promoter EF1alpha and mU6

Cloning Information

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.06.13.544831 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2 was a gift from Martin Kampmann (Addgene plasmid # 217635 ; http://n2t.net/addgene:217635 ; RRID:Addgene_217635)
  • For your References section:

    CRISPR screening by AAV episome-sequencing (CrAAVe-seq): a scalable cell-type-specific in vivo platform uncovers neuronal essential genes. Ramani B, Rose IVL, Teyssier N, Pan A, Danner-Bocks S, Sanghal T, Yadanar L, Tian R, Ma K, Palop JJ, Kampmann M. Nat Neurosci. 2025 Aug 22. doi: 10.1038/s41593-025-02043-9. 10.1038/s41593-025-02043-9 PubMed 40847019