pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2
(Plasmid
#217635)
-
PurposeAAV backbone for sgRNA expression. Contains a Lox-flanked handle sequence for Cre-dependent PCR amplification of sgRNAs. Protospacer is cloned between BstXI and BlpI.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217635 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-U6- sgRNA-CMV-GFP (Addgene #85451)
-
Backbone manufacturerHetian Lei
- Backbone size w/o insert (bp) 2904
- Total vector size (bp) 6016
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemU6-sgRNA, Handle sequence, EF1a-mTagBFP2
-
gRNA/shRNA sequenceNon-targeting control in mouse genetic background (mNTC194): GGATGCATAGATGAACGGAT
-
SpeciesSynthetic; mTagBFP2 derived from Entacmaea quadricolor
- Promoter EF1alpha and mU6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer oIR007: ccaactccatcactaggggttcct
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.06.13.544831 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2 was a gift from Martin Kampmann (Addgene plasmid # 217635 ; http://n2t.net/addgene:217635 ; RRID:Addgene_217635) -
For your References section:
CRISPR screening by AAV episome-sequencing (CrAAVe-seq): a scalable cell-type-specific in vivo platform uncovers neuronal essential genes. Ramani B, Rose IVL, Teyssier N, Pan A, Danner-Bocks S, Sanghal T, Yadanar L, Tian R, Ma K, Palop JJ, Kampmann M. Nat Neurosci. 2025 Aug 22. doi: 10.1038/s41593-025-02043-9. 10.1038/s41593-025-02043-9 PubMed 40847019