pLentiCMV_HyPer7RgDAAO
(Plasmid
#217653)
-
PurposeExpresses the fusion of HyPer7,a H2O2 sensor, and Rhodotorula gracilis D amino acid oxidase (DAAO) to measure transport of D amino acids across the plasma membrane
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217653 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti CMV Blast Dest
-
Backbone manufacturerEric Campeau, Paul Kaufman
- Backbone size w/o insert (bp) 9341
- Total vector size (bp) 10266
-
Modifications to backboneInserted HyPer7-DAAO fusion at the att sites of the vector backbone.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHyPer7 D amino acid oxidase
-
Alt nameHyPer7 DAAO
-
SpeciesNeisseria meningitidis, Rhodotorula gracilis
-
Insert Size (bp)2638
-
MutationFused DAAO to the C-terminus of HyPer7 using a Gly-Gly-Ser-Gly link while also removing the ATG start codon from DAAO
- Promoter CMV
-
Tag
/ Fusion Protein
- Nuclear export signal (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byValeriy V Pak and Vsevolod V Belousov
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit Johal et al., 2025 (https://doi.org/10.1016/j.xpro.2025.103929) for a description of the STAR protocol that can be used with this biosensor.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCMV_HyPer7RgDAAO was a gift from Seth Parker (Addgene plasmid # 217653 ; http://n2t.net/addgene:217653 ; RRID:Addgene_217653) -
For your References section:
Restricting lysine normalizes toxic catabolites associated with ALDH7A1 deficiency in cells and mice. Johal AS, Al-Shekaili HH, Abedrabbo M, Kehinde AZ, Towriss M, Koe JC, Hewton KG, Thomson SB, Ciernia AV, Leavitt B, Parker SJ. Cell Rep. 2024 Dec 24;43(12):115069. doi: 10.1016/j.celrep.2024.115069. Epub 2024 Dec 10. 10.1016/j.celrep.2024.115069 PubMed 39661514