Skip to main content

pLentiCMV_HyPer7RgDAAO
(Plasmid #217653)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217653 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti CMV Blast Dest
  • Backbone manufacturer
    Eric Campeau, Paul Kaufman
  • Backbone size w/o insert (bp) 9341
  • Total vector size (bp) 10266
  • Modifications to backbone
    Inserted HyPer7-DAAO fusion at the att sites of the vector backbone.
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HyPer7 D amino acid oxidase
  • Alt name
    HyPer7 DAAO
  • Species
    Neisseria meningitidis, Rhodotorula gracilis
  • Insert Size (bp)
    2638
  • Mutation
    Fused DAAO to the C-terminus of HyPer7 using a Gly-Gly-Ser-Gly link while also removing the ATG start codon from DAAO
  • Promoter CMV
  • Tag / Fusion Protein
    • Nuclear export signal (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Valeriy V Pak and Vsevolod V Belousov
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit Johal et al., 2025 (https://doi.org/10.1016/j.xpro.2025.103929) for a description of the STAR protocol that can be used with this biosensor.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCMV_HyPer7RgDAAO was a gift from Seth Parker (Addgene plasmid # 217653 ; http://n2t.net/addgene:217653 ; RRID:Addgene_217653)
  • For your References section:

    Restricting lysine normalizes toxic catabolites associated with ALDH7A1 deficiency in cells and mice. Johal AS, Al-Shekaili HH, Abedrabbo M, Kehinde AZ, Towriss M, Koe JC, Hewton KG, Thomson SB, Ciernia AV, Leavitt B, Parker SJ. Cell Rep. 2024 Dec 24;43(12):115069. doi: 10.1016/j.celrep.2024.115069. Epub 2024 Dec 10. 10.1016/j.celrep.2024.115069 PubMed 39661514