Skip to main content

gRNA3_NIPBL_Cas9-hGem-for_N-terminal_tagging
(Plasmid #217662)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217662 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem-Bpil-P2A-mCherry
  • Backbone size w/o insert (bp) 9643
  • Total vector size (bp) 9346
  • Vector type
    Mammalian Expression, Bacterial Expression, CRISPR
  • Selectable markers
    mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA3 for N terminal tagging of NIPBL
  • gRNA/shRNA sequence
    caccgtgtccccattactactcttg
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Entrez Gene
    NIPBL (a.k.a. CDLS, CDLS1, IDN3, IDN3-B, Scc2)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer GATGGGGAGAGTGAAGCAGAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gRNA3_NIPBL_Cas9-hGem-for_N-terminal_tagging was a gift from Daniel Gerlich (Addgene plasmid # 217662 ; http://n2t.net/addgene:217662 ; RRID:Addgene_217662)
  • For your References section:

    Cohesin-mediated DNA loop extrusion resolves sister chromatids in G2 phase. Batty P, Langer CC, Takacs Z, Tang W, Blaukopf C, Peters JM, Gerlich DW. EMBO J. 2023 Aug 15;42(16):e113475. doi: 10.15252/embj.2023113475. Epub 2023 Jun 26. 10.15252/embj.2023113475 PubMed 37357575