hNTa1-qgRNA-pYJA5
(Plasmid
#217779)
-
PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloning
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217779 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepYJA5
-
Backbone manufacturerAdriano Aguzzi (Addgene #217778)
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 9106
-
Vector typeMammalian Expression, Lentiviral, CRISPR, Synthetic Biology
-
Selectable markersPuromycin ; TagBFP
Growth in Bacteria
-
Bacterial Resistance(s)Trimethoprim, 15 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsThe NEB stable competent bacteria strain has a resistance to tetracycline, so we grow the bacteria transformed with our plasmid with both trimethoprim (15ug/ml) and tetracycline (15ug/ml) using the Terrific Broth medium (https://openwetware.org/wiki/Terrific_Broth) for two overnights at 30 °C. LB medium could also be used but with a lower yield.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
-
gRNA/shRNA sequencesg1: gccaaaggccaccaatgatt; sg2: cagaattgcgtgggctacgt; sg3: caggaacctcatgtaagcca; sg4: agctgaaaatatacgtattc
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1800
- Promoter human U6, mouse U6, human H1, human 7SK
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGAGCCGGTTGGCGCCTAC
- 3′ sequencing primer AGTACCGGGCCCTACGCGTT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hNTa1-qgRNA-pYJA5 was a gift from Adriano Aguzzi (Addgene plasmid # 217779 ; http://n2t.net/addgene:217779 ; RRID:Addgene_217779) -
For your References section:
Arrayed CRISPR libraries for the genome-wide activation, deletion and silencing of human protein-coding genes. Yin JA, Frick L, Scheidmann MC, Liu T, Trevisan C, Dhingra A, Spinelli A, Wu Y, Yao L, Vena DL, Knapp B, Guo J, De Cecco E, Ging K, Armani A, Oakeley EJ, Nigsch F, Jenzer J, Haegele J, Pikusa M, Tager J, Rodriguez-Nieto S, Bouris V, Ribeiro R, Baroni F, Bedi MS, Berry S, Losa M, Hornemann S, Kampmann M, Pelkmans L, Hoepfner D, Heutink P, Aguzzi A. Nat Biomed Eng. 2024 Dec 4. doi: 10.1038/s41551-024-01278-4. 10.1038/s41551-024-01278-4 PubMed 39633028