CRISPRoff-mScarletI
(Plasmid
#217783)
-
PurposeExpresses CRISPRoff-mScarletI (DNMT3A-DNMT3L-XTEN80-dCas9-HA-2xNLS-mScarletI-KRAB) downstream of the CAG promoter for gene epigenetic silencing
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217783 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCRISPRoff-v2.1
-
Backbone manufacturerLuke Gilbert (Addgene plasmid # 167981)
- Backbone size w/o insert (bp) 4836
- Total vector size (bp) 11874
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRISPRoff-mScarletI (DNMT3A-DNMT3L-dCas9-mScarletI-KRAB)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)7041
- Promoter CAG
-
Tags
/ Fusion Proteins
- HA (C terminal on insert)
- mScarletI (C terminal on insert)
- 2xNLS (C terminal on insert)
- DNMT3A-DNMT3L (N terminal on insert)
- KRAB (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggcaaagaattctgcagtcg
- 3′ sequencing primer ccaccaccttctgataggc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe plasmid was generated by replacing the BFP sequence with the mScarletI sequence originated from the addgene plasmid #85044.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CRISPRoff-mScarletI was a gift from Adriano Aguzzi (Addgene plasmid # 217783 ; http://n2t.net/addgene:217783 ; RRID:Addgene_217783) -
For your References section:
Arrayed CRISPR libraries for the genome-wide activation, deletion and silencing of human protein-coding genes. Yin JA, Frick L, Scheidmann MC, Liu T, Trevisan C, Dhingra A, Spinelli A, Wu Y, Yao L, Vena DL, Knapp B, Guo J, De Cecco E, Ging K, Armani A, Oakeley EJ, Nigsch F, Jenzer J, Haegele J, Pikusa M, Tager J, Rodriguez-Nieto S, Bouris V, Ribeiro R, Baroni F, Bedi MS, Berry S, Losa M, Hornemann S, Kampmann M, Pelkmans L, Hoepfner D, Heutink P, Aguzzi A. Nat Biomed Eng. 2024 Dec 4. doi: 10.1038/s41551-024-01278-4. 10.1038/s41551-024-01278-4 PubMed 39633028