p205-5'-Switch-ON
(Plasmid
#217884)
-
Purpose(Empty Backbone) Retroviral Switch-ON vector for sgRNA expression; U6-BbsIx2-SWITCH-ON-scaffold; neoR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217884 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepQCXIX
-
Backbone manufacturerderivative of pQCXIX was a kind gift of J Zuber and T Hoffmann (Fellmann et al Cell Rep. 2013 Dec 26;5(6):1704-13)
-
Vector typeMammalian Expression, Retroviral, Cre/Lox, CRISPR
- Promoter hU6
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GCATATACGATACAAGGCTGTTAGAGAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p205-5'-Switch-ON was a gift from Ulrich Elling (Addgene plasmid # 217884 ; http://n2t.net/addgene:217884 ; RRID:Addgene_217884) -
For your References section:
CRISPR-Switch regulates sgRNA activity by Cre recombination for sequential editing of two loci. Chylinski K, Hubmann M, Hanna RE, Yanchus C, Michlits G, Uijttewaal ECH, Doench J, Schramek D, Elling U. Nat Commun. 2019 Nov 29;10(1):5454. doi: 10.1038/s41467-019-13403-y. 10.1038/s41467-019-13403-y PubMed 31784531