p944-SWITCH-OVER insert: EF1a-Puro
(Plasmid
#217891)
-
Purpose(Empty Backbone) insert vector for Switch-OVER: Single loxP-STOP-EF1a-Puro-mU6
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217891 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
-
Modifications to backboneThis plasmid must be used with p1071-Lenti-Single loxP. For further information please refer to Supplementary Figure 11 – Construction of Switch-OVER vectors, Chylinski, K., Hubmann, M., Hanna, R.E. et al. CRISPR-Switch regulates sgRNA activity by Cre recombination for sequential editing of two loci. Nat Commun 10, 5454 (2019). https://doi.org/10.1038/s41467-019-13403-y
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox, CRISPR
- Promoter hU6
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCATATACGATACAAGGCTGTTAGAGAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p944-SWITCH-OVER insert: EF1a-Puro was a gift from Ulrich Elling (Addgene plasmid # 217891 ; http://n2t.net/addgene:217891 ; RRID:Addgene_217891) -
For your References section:
CRISPR-Switch regulates sgRNA activity by Cre recombination for sequential editing of two loci. Chylinski K, Hubmann M, Hanna RE, Yanchus C, Michlits G, Uijttewaal ECH, Doench J, Schramek D, Elling U. Nat Commun. 2019 Nov 29;10(1):5454. doi: 10.1038/s41467-019-13403-y. 10.1038/s41467-019-13403-y PubMed 31784531