-
PurposeExpresses truncated RvLEAM protein under IPTG induction in bacterial host cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 218122 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-15b
-
Backbone manufacturerNovagen/Millipore
- Backbone size w/o insert (bp) 5708
- Total vector size (bp) 6078
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRvLEAMshort
-
Alt nameGroup 3 late-embryogenesis abundant protein, LEAM
-
SpeciesRamazzottius varieornatus
-
Insert Size (bp)441
-
MutationTruncated form (58-181aa)
-
GenBank ID
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHIS (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2024.02.06.579238v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET15b-RvLEAMshort was a gift from Ci Ji Lim (Addgene plasmid # 218122 ; http://n2t.net/addgene:218122 ; RRID:Addgene_218122) -
For your References section:
Small LEA proteins as an effective air-water interface protectant for fragile samples during cryo-EM grid plunge freezing. Abe KM, Lim CJ. bioRxiv [Preprint]. 2024 Feb 11:2024.02.06.579238. doi: 10.1101/2024.02.06.579238. 10.1101/2024.02.06.579238 PubMed 38370693