Skip to main content

pOET5 rota-VLP
(Plasmid #218147)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218147 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pOET5.1
  • Backbone manufacturer
    Oxford Expression Technologies
  • Backbone size w/o insert (bp) 4581
  • Total vector size (bp) 5775
  • Modifications to backbone
    P10 promoter replaced with CMV enhancer and promoter
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rotavirus VP6
  • Alt name
    Rotavirus capsid protein VP6
  • Alt name
    VP6
  • Species
    H. sapiens (human); Human rotavirus
  • Insert Size (bp)
    1194
  • GenBank ID
    ACL93331.1
  • Promoter Polyhedrin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CTGTTACGAAAACAGTAAAATACTT
  • 3′ sequencing primer TAAATCAACAACGCACAGAATCTAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Gene synthetically produced and cloned by GenScript.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOET5 rota-VLP was a gift from Minna Hankaniemi (Addgene plasmid # 218147 ; http://n2t.net/addgene:218147 ; RRID:Addgene_218147)