Skip to main content

TMEM165 g2 LentiCRISPRv2-mCherry
(Plasmid #218661)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218661 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LentiCRISPRv2-mCherry (Addgene Plasmid #99154)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TMEM165
  • gRNA/shRNA sequence
    ACATAGTATGTATAGACCCT
  • Species
    H. sapiens (human)
  • Entrez Gene
    TMEM165 (a.k.a. TPARL, TMPT27)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TMEM165 g2 LentiCRISPRv2-mCherry was a gift from Wade Harper (Addgene plasmid # 218661 ; http://n2t.net/addgene:218661 ; RRID:Addgene_218661)
  • For your References section:

    Spatiotemporal proteomic profiling of cellular responses to NLRP3 agonists. Hollingsworth LR, Veeraraghavan P, Paulo JA, Harper JW. bioRxiv 2024.04.19.590338 10.1101/2024.04.19.590338