pCAG-EGFP-C-IFT74
              
              
                (Plasmid
                
                #218730)
              
            
            
            
          - 
            PurposeExpresses N-terminally EGFP-tagged IFT74 in mammalian cells
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 218730 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepCAG-EGFP-C
- 
              Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6767
- 
              Vector typeMammalian Expression
- 
                Selectable markersNeomycin (select with G418)
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameIFT74
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)1314
- 
                        Entrez GeneIFT74 (a.k.a. BBS20, CCDC2, CMG-1, CMG1)
- Promoter CAG
- 
    
        Tag
        / Fusion Protein
    - EGFP (N terminal on backbone)
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site XhoI (destroyed during cloning)
- 5′ sequencing primer CTGAGCAAAGACCCCAACGAG
- 3′ sequencing primer GCCAGAAGTCAGATGCTC (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pCAG-EGFP-C-IFT74 was a gift from Kazuhisa Nakayama (Addgene plasmid # 218730 ; http://n2t.net/addgene:218730 ; RRID:Addgene_218730)
- 
                For your References section: RABL2 interacts with the intraflagellar transport-B complex and CEP19 and participates in ciliary assembly. Nishijima Y, Hagiya Y, Kubo T, Takei R, Katoh Y, Nakayama K. Mol Biol Cell. 2017 Jun 15;28(12):1652-1666. doi: 10.1091/mbc.E17-01-0017. Epub 2017 Apr 20. 10.1091/mbc.E17-01-0017 PubMed 28428259
