-
Purpose3` circularization cassette to induce Cre-mediated circularization of a genomic region flanked by loxP sites with H2B-GFP reconstitution and mScarlet expression from the chromosome
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219565 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneEntry vector - pNC
- Total vector size (bp) 5654
-
Vector typeUnspecified
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHygroR_2A_H2B-GFP-N_loxP_mScarlet
-
SpeciesSynthetic
-
Insert Size (bp)3141
- Promoter EF-1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tagtcgccgtgaacgttcttt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
3` CC: Hygro – H2B-GFP-N – loxP – mScarlet was a gift from Andrea Ventura (Addgene plasmid # 219565 ; http://n2t.net/addgene:219565 ; RRID:Addgene_219565) -
For your References section:
Engineered extrachromosomal oncogene amplifications promote tumorigenesis. Pradella D, Zhang M, Gao R, Yao MA, Gluchowska KM, Cendon-Florez Y, Mishra T, La Rocca G, Weigl M, Jiao Z, Nguyen HHM, Lisi M, Ozimek MM, Mastroleo C, Chen K, Grimm F, Luebeck J, Zhang S, Zolli AA, Sun EG, Dameracharla B, Zhao Z, Pritykin Y, Sigel C, Chang HY, Mischel PS, Bafna V, Antonescu CR, Ventura A. Nature. 2024 Dec 18. doi: 10.1038/s41586-024-08318-8. 10.1038/s41586-024-08318-8 PubMed 39695225