Skip to main content

pJP_Azul01
(Plasmid #219670)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 219670 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJFR2
  • Backbone size w/o insert (bp) 5846
  • Total vector size (bp) 8364
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    similar to T7 RNA polymerase (core)
  • Promoter pJ23105

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tacgaccagttcgctgacca
  • 3′ sequencing primer ttatgctgtagaacggag
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    similar to YF1-fixJ
  • Promoter LacIq35

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctccgttctacagcataag
  • 3′ sequencing primer gtcgaacgaccgagcgtagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.03.28.586779 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJP_Azul01 was a gift from Yolanda Schaerli (Addgene plasmid # 219670 ; http://n2t.net/addgene:219670 ; RRID:Addgene_219670)
  • For your References section:

    From resonance to chaos by modulating spatiotemporal patterns through a synthetic optogenetic oscillator. Park JH, Hollo G, Schaerli Y. Nat Commun. 2024 Aug 23;15(1):7284. doi: 10.1038/s41467-024-51626-w. 10.1038/s41467-024-51626-w PubMed 39179558