pJP_Azul01
(Plasmid
#219670)
-
PurposeBlue light inducible system
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 219670 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJFR2
- Backbone size w/o insert (bp) 5846
- Total vector size (bp) 8364
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namesimilar to T7 RNA polymerase (core)
- Promoter pJ23105
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer tacgaccagttcgctgacca
- 3′ sequencing primer ttatgctgtagaacggag
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesimilar to YF1-fixJ
- Promoter LacIq35
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ctccgttctacagcataag
- 3′ sequencing primer gtcgaacgaccgagcgtagc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.03.28.586779 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJP_Azul01 was a gift from Yolanda Schaerli (Addgene plasmid # 219670 ; http://n2t.net/addgene:219670 ; RRID:Addgene_219670) -
For your References section:
From resonance to chaos by modulating spatiotemporal patterns through a synthetic optogenetic oscillator. Park JH, Hollo G, Schaerli Y. Nat Commun. 2024 Aug 23;15(1):7284. doi: 10.1038/s41467-024-51626-w. 10.1038/s41467-024-51626-w PubMed 39179558